Checking Character Vectors for Valid Letters#
In this article, we will explore how to take a character vector and verify if every single character in it is one of the letters A, C, G, and T.
Defining the Character Vector#
Let’s start with an example character vector:
['a', 't', 'g', 'z']
In this case, the vector consists of valid letters (A, T, G) and an invalid letter (z).
Function Definition#
We will define a function, referred to as Omega (the rightmost letter of the Greek alphabet), to perform the check. We can leverage membership testing in our programming environment to see if each letter is among the set of valid letters (A, C, G, T). In APL, we can use a simple approach for this:
{⍵∊'ACGT'} 'ATGCTTCAGAAAGGTCTTACG'
This expression checks if each character in the string is a member of the set ‘ACGT’, outputting a vector of 1s (valid) and 0s (invalid).
The next step is to ensure that we check if all character checks return true. We can accomplish this using a logical AND reduction:
{∧/⍵∊'ACGT'} 'ATGCTTCAGAAAGGTCTTACG'
This will result in 1 (or true) if all characters are valid.
If we include a character that is not valid, the result would yield 0 (or False):
{∧/⍵∊'ACGT'} 'ATGCTTCAGAAAGGTxCTTACG'
The result here would be 0, indicating the presence of an invalid character.
Function Optimization#
We can define this operation as a function and apply it. However, we can simplify some syntactic elements in this function definition by expressing it in a point-free style.
Point-Free Style#
To translate our operation into a point-free style, we need to recognize that we have two function applications: membership and the AND reduction.
To express the membership function in point-free style, we can bind one argument to the membership function, thus deriving a new function that takes only one argument. In APL, we can define this function easily:
F ← {∧/⍵∊'ACGT'}
Thus, we eliminate the need to specify the argument while modifying the function definition.
Final Implementation#
At this point, we have two pure functions:
The A, C, G, T membership function.
The
ANDreduction function.
We can now combine these into a single function, called G:
G ← ∧/∊∘'ACGT'
Applying the Function#
Now, we can apply this function to our character vector. Let’s see what result we get when we check a string with an invalid character:
F 'ATGCTTCAGAAAGGTxCTTACG'
This would return 0, indicating that not all characters are valid.
Meanwhile, checking a valid string:
G 'ATGCTTCAGAAAGGTCTTACG'
This will return 1, confirming that all characters are valid.
Conclusion#
This approach demonstrates how to efficiently check character vectors for membership in a specified set using functional programming techniques. Thank you for reading!